Open Access

Table 1

List of primers were used for the PCR amplification and sequencing of integrons in the present study.

Target region Primer sequence (5́ → 3́) Size of product Annealing Temperature References
intI-1F TCATGGCTTGTTATGACTGT
GTAGGGCTTATTATGCACGC
600 bp* 57̊C 26
intI-1R
intI-2F GATGCCATCGCAAGTACGAG
CGGGATCCCGGACGGCATGCACGATTTGTA
750 bp* 57̊C 27
intI-2R
intI-3F GCCTCCGGCAGCGACTTTCAG
ACGGATCTGCCAAACCTGACT
650 bp* 59̊C 28
intI-3R
*

bp = base pair, F = forward sequence, R = reverse sequence.