Open Access

Table 1

List of primers were used for the PCR amplification and sequencing of integrons in the present study.

Target region Primer sequence (5́ → 3́) Size of product Annealing Temperature References
intI-1F TCATGGCTTGTTATGACTGT
GTAGGGCTTATTATGCACGC
600 bp* 57̊C 26
intI-1R
intI-2F GATGCCATCGCAAGTACGAG
CGGGATCCCGGACGGCATGCACGATTTGTA
750 bp* 57̊C 27
intI-2R
intI-3F GCCTCCGGCAGCGACTTTCAG
ACGGATCTGCCAAACCTGACT
650 bp* 59̊C 28
intI-3R
*

bp = base pair, F = forward sequence, R = reverse sequence.

Current usage metrics show cumulative count of Article Views (full-text article views including HTML views, PDF and ePub downloads, according to the available data) and Abstracts Views on Vision4Press platform.

Data correspond to usage on the plateform after 2015. The current usage metrics is available 48-96 hours after online publication and is updated daily on week days.

Initial download of the metrics may take a while.