Open Access

Table 1

Primers used for qPCR.

Gene Forward primer Reverse primer
p53 GTTCCGAGAGCTGAATGAGG TTTTATGGCGGGACGTAGAC
Caspase9 AGCCAGATGCTGTCCCATAC CAGGAGACAAAACCTGGGAA
Caspase3 GGTATTGAGACAGACAGTGG CATGGGATCTGTTTCTTTGC
IL6 TCCTACCCCAACTTCCAATGCTC TTGGATGGTCTTGGTCCTTAGCC
TGFβ1 AAGAAGTCACCCGCGTGCTA TGTGTGATGTCTTTGGTTTTGTCA
β-actin AAGTCCCTCACCCTCCCAAAAG AAGCAATGCTGTCACCTTCCC

AST serum level (U/L)

ALP serum level (U/L)